Online Inquiry
CLK4 Knockout Cell Line
SPL-00998
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | CLK4 |
| Gene Abbr. | CLK4 |
| Gene ID | 57396 |
| Full Name | CDC like kinase 4 |
| Species | Human |
| Genomic Locus | chr5:178623333 |
| Transcript | NM_020666 |
| WT Expression Level | 9.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of CLK4. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTATCGTGGAAGTCACAAG |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGCAATGAGCACTACAACATACCCATC Reverse: CACCTAAAAAGATTTTGGAGCCTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.