CLCN2 Knockout Cell Line - CD BioSciences

service-banner

CLCN2 Knockout Cell Line

CLCN2 Knockout Cell Line

SPL-00978

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name CLCN2
Gene Abbr. CLCN2
Gene ID 1181
Full Name chloride voltage-gated channel 2
Alias CIC-2, CLC2, ECA2, ECA3, EGI11
Species Human
Genomic Locus chr3:184359067
Transcript NM_004366
WT Expression Level 9.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of CLCN2.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GAAGCTGCTCGGATTCGCCT
PCR Primer Forward: AAAGTGCTCCTACCCCTTTTACTG
Reverse: GAAGAGGAGTGGAGGCTCTAAGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.