Online Inquiry
CLCN2 Knockout Cell Line
SPL-00977
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 176bp insertion |
| Target Information | |
|---|---|
| Target Name | CLCN2 |
| Gene Abbr. | CLCN2 |
| Gene ID | 1181 |
| Full Name | chloride voltage-gated channel 2 |
| Alias | CIC-2, CLC2, ECA2, ECA3, EGI11 |
| Species | Human |
| Genomic Locus | chr3:184359067 |
| Transcript | NM_004366 |
| WT Expression Level | 9.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 176bp insertion in a coding exon of CLCN2. |
| Description | 176bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAGCTGCTCGGATTCGCCT |
| PCR Primer |
Forward: AAAGTGCTCCTACCCCTTTTACTG Reverse: GAAGAGGAGTGGAGGCTCTAAGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.