Online Inquiry
CLASP1 Knockout Cell Line
SPL-00976
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | CLASP1 |
| Gene Abbr. | CLASP1 |
| Gene ID | 23332 |
| Full Name | cytoplasmic linker associated protein 1 |
| Alias | MAST1 |
| Species | Human |
| Genomic Locus | chr2:121605725 |
| Transcript | NM_001142274 |
| WT Expression Level | 12.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of CLASP1. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGATGGACTTGCTACCTCT |
| PCR Primer |
Forward: GAATGAAATAACCCAAGGCCACAAT Reverse: CTAGCTTTTGCTGGATCTGGATTTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.