Online Inquiry
CILK1 Knockout Cell Line
SPL-00971
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | CILK1 |
| Gene Abbr. | CILK1 |
| Gene ID | 22858 |
| Full Name | ciliogenesis associated kinase 1 |
| Alias | ECO, EJM10, ICK, LCK2, MRK |
| Species | Human |
| Genomic Locus | chr6:53019303 |
| Transcript | NM_014920 |
| WT Expression Level | 8.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of ICK. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAAGTTCTGGTCCCATGCAG |
| PCR Primer |
Forward: TCACCATCTGGTAGATACATAATCTG Reverse: TCGAAGGACTCTACATTATCTGTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.