Online Inquiry
CIB1 cDNA ORF Clone, Human, C-Myc tag
SPD-03407
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human calcium and integrin binding 1 (calmyrin) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CIB1 |
Gene Abbr. | CIB1 |
Gene ID | 10519 |
Full Name | calcium and integrin binding 1 |
Alias | CIB, CIBP, KIP1, PRKDCIP, SIP2-28 |
Introduction | The protein encoded by this gene is a member of the calcium-binding protein family. The specific function of this protein has not yet been determined; however this protein is known to interact with DNA-dependent protein kinase and may play a role in kinase-phosphatase regulation of DNA end joining. This protein also interacts with integrin alpha(IIb)beta(3), which may implicate this protein as a regulatory molecule for alpha(IIb)beta(3). [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human calcium and integrin binding 1 (calmyrin) with C terminal Myc tag. |
NCBI Ref Seq | NM_006384.3 |
RefSeq ORF Size | 576 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.