CHRNB2 Knockout Cell Line - CD BioSciences

service-banner

CHRNB2 Knockout Cell Line

CHRNB2 Knockout Cell Line

SPL-00968

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name CHRNB2
Gene Abbr. CHRNB2
Gene ID 1141
Full Name cholinergic receptor nicotinic beta 2 subunit
Alias EFNL3, nAChRB2
Species Human
Genomic Locus chr1:154569515
Transcript NM_000748
WT Expression Level 0.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of CHRNB2.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence ATAAGCTTGTTGTAGCGGGA
PCR Primer Forward: TTTGCAGTATCCTTAGGGATGTAGG
Reverse: GAAGCACACAAGCATTAACACATTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.