Online Inquiry
CHRNB2 Knockout Cell Line
SPL-00967
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | CHRNB2 |
| Gene Abbr. | CHRNB2 |
| Gene ID | 1141 |
| Full Name | cholinergic receptor nicotinic beta 2 subunit |
| Alias | EFNL3, nAChRB2 |
| Species | Human |
| Genomic Locus | chr1:154569515 |
| Transcript | NM_000748 |
| WT Expression Level | 0.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of CHRNB2. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATAAGCTTGTTGTAGCGGGA |
| PCR Primer |
Forward: TTTGCAGTATCCTTAGGGATGTAGG Reverse: GAAGCACACAAGCATTAACACATTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.