Online Inquiry
CHRNA7 Knockout Cell Line
SPL-00966
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 32bp deletion |
| Target Information | |
|---|---|
| Target Name | CHRNA7 |
| Gene Abbr. | CHRNA7 |
| Gene ID | 1139 |
| Full Name | cholinergic receptor nicotinic alpha 7 subunit |
| Alias | CHRNA7-2, NACHRA7 |
| Species | Human |
| Genomic Locus | chr15:32111835 |
| Transcript | NM_000746 |
| WT Expression Level | 3.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 32bp deletion in a coding exon of CHRNA7. |
| Description | 32bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAACGAACAGTCTTCACCCC |
| PCR Primer |
Forward: TCTGGAATTCTCTTTGGTTTTGCAC Reverse: GTGGCCCCAGATCATAGATAACAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.