Online Inquiry
CHEK2 Knockout Cell Line
SPL-00960
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
23bp deletion |
Target Information | |
---|---|
Target Name | Chk2 |
Gene Abbr. | CHEK2 |
Gene ID | 11200 |
Full Name | checkpoint kinase 2 |
Alias | CDS1, CHK2, HuCds1, LFS2, PP1425 |
Species | Human |
Genomic Locus | chr22:28711984 |
Transcript | NM_145862 |
WT Expression Level | 60.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of CHEK2. |
Description | 23bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGGTAAAGCTGGCTTTCGAG |
PCR Primer |
Forward: TCAAAGATGCCCCAAAATTTTCCAT Reverse: CTTTGTTTTTCCCTCTAGTGGTGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.