Online Inquiry
CHEK2 cDNA ORF Clone, Human, N-His tag
SPD-03340
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human CHK2 checkpoint homolog (S. pombe) with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Chk2 |
Gene Abbr. | CHEK2 |
Gene ID | 11200 |
Full Name | checkpoint kinase 2 |
Alias | CDS1, CHK2, HuCds1, LFS2, PP1425 |
Introduction | Chk2 is the mammalian orthologue of the budding yeast Rad53 and fission yeast Cds1 checkpoint kinases. The amino-terminal domain of Chk2 contains a series of seven serine or threonine residues (Ser19, Thr26, Ser28, Ser33, Ser35, Ser50, and Thr68) each followed by glutamine (SQ or TQ motif). These are known to be preferred sites for phosphorylation by ATM/ATR kinases. After DNA damage by ionizing radiation UV irradiation, or hydroxyurea treatment, Thr68 and other sites in this region become phosphorylated by ATM/ATR. The SQ/TQ cluster domain, therefore, seems to have a regulatory function. Phosphorylation at Thr68 is a prerequisite for the subsequent activation step, which is attributable to autophosphorylation of Chk2 at residues Thr383 and Thr387 in the activation loop of the kinase domain. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human CHK2 checkpoint homolog (S. pombe) with N terminal His tag. |
NCBI Ref Seq | NM_007194.3 |
RefSeq ORF Size | 1632 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.