CHEK2 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

CHEK2 cDNA ORF Clone, Human, C-HA tag

CHEK2 cDNA ORF Clone, Human, C-HA tag

SPD-03337

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human CHK2 checkpoint homolog (S. pombe) with C terminal HA tag.
Target Information
Species Human
Target Name Chk2
Gene Abbr. CHEK2
Gene ID 11200
Full Name checkpoint kinase 2
Alias CDS1, CHK2, HuCds1, LFS2, PP1425
Introduction Chk2 is the mammalian orthologue of the budding yeast Rad53 and fission yeast Cds1 checkpoint kinases. The amino-terminal domain of Chk2 contains a series of seven serine or threonine residues (Ser19, Thr26, Ser28, Ser33, Ser35, Ser50, and Thr68) each followed by glutamine (SQ or TQ motif). These are known to be preferred sites for phosphorylation by ATM/ATR kinases. After DNA damage by ionizing radiation UV irradiation, or hydroxyurea treatment, Thr68 and other sites in this region become phosphorylated by ATM/ATR. The SQ/TQ cluster domain, therefore, seems to have a regulatory function. Phosphorylation at Thr68 is a prerequisite for the subsequent activation step, which is attributable to autophosphorylation of Chk2 at residues Thr383 and Thr387 in the activation loop of the kinase domain.
Product Details
Description Full length Clone DNA of Human CHK2 checkpoint homolog (S. pombe) with C terminal HA tag.
NCBI Ref Seq NM_007194.3
RefSeq ORF Size 1632 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.