Online Inquiry
Chek1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-03304
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse checkpoint kinase 1 homolog (S. pombe) with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Chk1 |
Gene Abbr. | Chek1 |
Gene ID | 12649 |
Full Name | checkpoint kinase 1 |
Alias | C85740, Chk1, rad27 |
Introduction | Chk1 kinase acts downstream of ATM/ATR kinase and plays an important role in DNA damage checkpoint control, embryonic development, and tumor suppression. Activation of Chk1 involves phosphorylation at Ser317 and Ser345 by ATM/ATR, followed by autophosphorylation of Ser296. Activation occurs in response to blocked DNA replication and certain forms of genotoxic stress. While phosphorylation at Ser345 serves to localize Chk1 to the nucleus following checkpoint activation phosphorylation at Ser317 along with site-specific phosphorylation of PTEN allows for re-entry into the cell cycle following stalled DNA replication. Chk1 exerts its checkpoint mechanism on the cell cycle, in part, by regulating the cdc25 family of phosphatases. Chk1 phosphorylation of cdc25A targets it for proteolysis and inhibits its activity through 14-3-3 binding. Activated Chk1 can inactivate cdc25C via phosphorylation at Ser216, blocking the activation of cdc2 and transition into mitosis. Centrosomal Chk1 has been shown to phosphorylate cdc25B and inhibit its activation of CDK1-cyclin B1, thereby abrogating mitotic spindle formation and chromatin condensation. Furthermore, Chk1 plays a role in spindle checkpoint function through regulation of aurora B and BubR1. Research studies have implicated Chk1 as a drug target for cancer therapy as its inhibition leads to cell death in many cancer cell lines. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse checkpoint kinase 1 homolog (S. pombe) with C terminal Flag tag. |
NCBI Ref Seq | NM_007691.4 |
RefSeq ORF Size | 1431 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 552T/C, 1293A/G not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 1.47kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.