CHEK1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

CHEK1 cDNA ORF Clone, Human, N-FLAG tag

CHEK1 cDNA ORF Clone, Human, N-FLAG tag

SPD-03319

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human CHK1 checkpoint homolog (S. pombe) with N terminal Flag tag.
Target Information
Species Human
Target Name Chk1
Gene Abbr. CHEK1
Gene ID 1111
Full Name checkpoint kinase 1
Alias CHK1
Introduction Chk1 kinase acts downstream of ATM/ATR kinase and plays an important role in DNA damage checkpoint control, embryonic development, and tumor suppression. Activation of Chk1 involves phosphorylation at Ser317 and Ser345 by ATM/ATR, followed by autophosphorylation of Ser296. Activation occurs in response to blocked DNA replication and certain forms of genotoxic stress. While phosphorylation at Ser345 serves to localize Chk1 to the nucleus following checkpoint activation phosphorylation at Ser317 along with site-specific phosphorylation of PTEN allows for re-entry into the cell cycle following stalled DNA replication. Chk1 exerts its checkpoint mechanism on the cell cycle, in part, by regulating the cdc25 family of phosphatases. Chk1 phosphorylation of cdc25A targets it for proteolysis and inhibits its activity through 14-3-3 binding. Activated Chk1 can inactivate cdc25C via phosphorylation at Ser216, blocking the activation of cdc2 and transition into mitosis. Centrosomal Chk1 has been shown to phosphorylate cdc25B and inhibit its activation of CDK1-cyclin B1, thereby abrogating mitotic spindle formation and chromatin condensation. Furthermore, Chk1 plays a role in spindle checkpoint function through regulation of aurora B and BubR1. Research studies have implicated Chk1 as a drug target for cancer therapy as its inhibition leads to cell death in many cancer cell lines.
Product Details
Description Full length Clone DNA of Human CHK1 checkpoint homolog (S. pombe) with N terminal Flag tag.
NCBI Ref Seq NM_001274.2
RefSeq ORF Size 1431 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.47kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.