Online Inquiry
CHD1L Knockout Cell Line
SPL-00957
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | CHD1L |
| Gene Abbr. | CHD1L |
| Gene ID | 9557 |
| Full Name | chromodomain helicase DNA binding protein 1 like |
| Alias | ALC1, CHDL |
| Species | Human |
| Genomic Locus | chr1:147266012 |
| Transcript | NM_004284 |
| WT Expression Level | 28.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of CHD1L. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACAGAAGTAGTGATATACCA |
| PCR Primer |
Forward: TCATTGCCTTGGTTCTACTTTTGTC Reverse: TTCCATCCCATATTCTTGGGATCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.