Online Inquiry
CHD1 Knockout Cell Line
SPL-00955
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 82bp deletion |
| Target Information | |
|---|---|
| Target Name | CHD1 |
| Gene Abbr. | CHD1 |
| Gene ID | 1105 |
| Full Name | chromodomain helicase DNA binding protein 1 |
| Alias | CHD-1, PILBOS |
| Species | Human |
| Genomic Locus | chr5:98903805 |
| Transcript | NM_001270 |
| WT Expression Level | 44.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 82bp deletion in a coding exon of CHD1. |
| Description | 82bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATCAAGCCTCATCTAATAG |
| PCR Primer |
Forward: TTCCCACAGAGTTCACATTTAGTTT Reverse: TGAGGCAGTAAAGATGGTGGTATAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.