Online Inquiry
CHCHD3 Knockout Cell Line
SPL-00952
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | CHCHD3 |
| Gene Abbr. | CHCHD3 |
| Gene ID | 54927 |
| Full Name | coiled-coil-helix-coiled-coil-helix domain containing 3 |
| Alias | MICOS19, MINOS3, Mic19, PPP1R22 |
| Species | Human |
| Genomic Locus | chr7:132975198 |
| Transcript | NM_017812 |
| WT Expression Level | 89.94 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of CHCHD3. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCGGGAGAGGATATGTAGCG |
| PCR Primer |
Forward: ATTATCAACACTAAAAGCTGGCACA Reverse: CAAGATGATTTCAGCTGTTGACCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.