CFL1 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

CFL1 cDNA ORF Clone, Rhesus, untagged

CFL1 cDNA ORF Clone, Rhesus, untagged

SPD-03553

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus cofilin 1 (non-muscle).
Target Information
Species Rhesus
Target Name Cofilin
Gene Abbr. CFL1
Gene ID 721882
Full Name cofilin 1
Introduction Cofilin and actin-depolymerization factor (ADF) are members of a family of essential conserved small actin-binding proteins that play pivotal roles in cytokinesis, endocytosis, embryonic development, stress response, and tissue regeneration. In response to stimuli, cofilin promotes the regeneration of actin filaments by severing preexisting filaments. The severing activity of cofilin is inhibited by LIMK or TESK phosphorylation at Ser3 of cofilin. Phosphorylation at Ser3 also regulates cofilin translocation from the nucleus to the cytoplasm.
Product Details
Description Full length Clone DNA of Rhesus cofilin 1 (non-muscle).
NCBI Ref Seq NM_001266605.1
RefSeq ORF Size 501 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.