Cfl1 cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Cfl1 cDNA ORF Clone, Mouse, N-Myc tag

Cfl1 cDNA ORF Clone, Mouse, N-Myc tag

SPD-03572

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cofilin 1, non-muscle with N terminal Myc tag.
Target Information
Species Mouse
Target Name Cofilin
Gene Abbr. Cfl1
Gene ID 12631
Full Name cofilin 1, non-muscle
Alias AA959946, Cof, co, n-c
Introduction Cofilin and actin-depolymerization factor (ADF) are members of a family of essential conserved small actin-binding proteins that play pivotal roles in cytokinesis, endocytosis, embryonic development, stress response, and tissue regeneration. In response to stimuli, cofilin promotes the regeneration of actin filaments by severing preexisting filaments. The severing activity of cofilin is inhibited by LIMK or TESK phosphorylation at Ser3 of cofilin. Phosphorylation at Ser3 also regulates cofilin translocation from the nucleus to the cytoplasm.
Product Details
Description Full length Clone DNA of Mouse cofilin 1, non-muscle with N terminal Myc tag.
NCBI Ref Seq NM_007687.5
RefSeq ORF Size 546 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.55kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.