Online Inquiry
Cfl1 cDNA ORF Clone, Mouse, C-HA tag
SPD-03568
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse cofilin 1, non-muscle with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Cofilin |
Gene Abbr. | Cfl1 |
Gene ID | 12631 |
Full Name | cofilin 1, non-muscle |
Alias | AA959946, Cof, co, n-c |
Introduction | Cofilin and actin-depolymerization factor (ADF) are members of a family of essential conserved small actin-binding proteins that play pivotal roles in cytokinesis, endocytosis, embryonic development, stress response, and tissue regeneration. In response to stimuli, cofilin promotes the regeneration of actin filaments by severing preexisting filaments. The severing activity of cofilin is inhibited by LIMK or TESK phosphorylation at Ser3 of cofilin. Phosphorylation at Ser3 also regulates cofilin translocation from the nucleus to the cytoplasm. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse cofilin 1, non-muscle with C terminal HA tag. |
NCBI Ref Seq | NM_007687.5 |
RefSeq ORF Size | 501 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.