CFL1 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

CFL1 cDNA ORF Clone, Human, C-His tag

CFL1 cDNA ORF Clone, Human, C-His tag

SPD-03576

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cofilin 1 (non-muscle) with C terminal His tag.
Target Information
Species Human
Target Name Cofilin
Gene Abbr. CFL1
Gene ID 1072
Full Name cofilin 1
Alias CFL, HEL-S-15, cofilin
Introduction Cofilin and actin-depolymerization factor (ADF) are members of a family of essential conserved small actin-binding proteins that play pivotal roles in cytokinesis, endocytosis, embryonic development, stress response, and tissue regeneration. In response to stimuli, cofilin promotes the regeneration of actin filaments by severing preexisting filaments. The severing activity of cofilin is inhibited by LIMK or TESK phosphorylation at Ser3 of cofilin. Phosphorylation at Ser3 also regulates cofilin translocation from the nucleus to the cytoplasm.
Product Details
Description Full length Clone DNA of Human cofilin 1 (non-muscle) with C terminal His tag.
NCBI Ref Seq BC011005
RefSeq ORF Size 546 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.55kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.