Cfh cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cfh cDNA ORF Clone, Mouse, untagged

Cfh cDNA ORF Clone, Mouse, untagged

SPD-03786

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse complement component factor h
Target Information
Species Mouse
Target Name Complement Factor H
Gene Abbr. Cfh
Gene ID 12628
Full Name complement component factor h
Alias Mud-1, NOM, S, Sa, Sas-1
Product Details
Description Full length Clone DNA of Mouse complement component factor h
NCBI Ref Seq NM_009888.3
RefSeq ORF Size 3759 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.