Cfd cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cfd cDNA ORF Clone, Mouse, untagged

Cfd cDNA ORF Clone, Mouse, untagged

SPD-03756

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse complement factor D (adipsin).
Target Information
Species Mouse
Target Name Complement Factor D
Gene Abbr. Cfd
Gene ID 11537
Full Name complement factor D (adipsin)
Alias A, Adn, DF
Product Details
Description Full length Clone DNA of Mouse complement factor D (adipsin).
NCBI Ref Seq NM_001291915.1
RefSeq ORF Size 777 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.78kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.