Cfb cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Cfb cDNA ORF Clone, Rat, N-Myc tag

Cfb cDNA ORF Clone, Rat, N-Myc tag

SPD-03729

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat complement factor B with N terminal Myc tag.
Target Information
Species Rat
Target Name Complement Factor B
Gene Abbr. Cfb
Gene ID 294257
Full Name complement factor B
Alias Bf, Da1-24
Introduction This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2.
Product Details
Description Full length Clone DNA of Rat complement factor B with N terminal Myc tag.
NCBI Ref Seq NM_212466.3
RefSeq ORF Size 2292 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.