Online Inquiry
CFB cDNA ORF Clone, Human, C-His tag
SPD-03735
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human complement factor B with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Complement Factor B |
Gene Abbr. | CFB |
Gene ID | 629 |
Full Name | complement factor B |
Alias | AHUS4, ARMD14, BF, BFD, CFAB |
Introduction | This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human complement factor B with C terminal His tag. |
NCBI Ref Seq | NM_001710.5 |
RefSeq ORF Size | 2340 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 450A/G not causing the amino acid variation. |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | HindIII (two restriction sites) + XbaI (6kb + 1.65kb + 0.71kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.