CENPE Knockout Cell Line - CD BioSciences

service-banner

CENPE Knockout Cell Line

CENPE Knockout Cell Line

SPL-00932

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name CENPE
Gene Abbr. CENPE
Gene ID 1062
Full Name centromere protein E
Alias CENP-E, KIF10, MCPH13, PPP1R61
Species Human
Genomic Locus chr4:103196174
Transcript NM_001813
WT Expression Level 21.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of CENPE.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence TGTATGGCAGAATCGATGAT
PCR Primer Forward: AACAAAACACACATACGCAAAGATT
Reverse: ACCTTAGGGAAGGGTATTTTCAGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.