Online Inquiry
CENPE Knockout Cell Line
SPL-00931
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | CENPE |
| Gene Abbr. | CENPE |
| Gene ID | 1062 |
| Full Name | centromere protein E |
| Alias | CENP-E, KIF10, MCPH13, PPP1R61 |
| Species | Human |
| Genomic Locus | chr4:103196174 |
| Transcript | NM_001813 |
| WT Expression Level | 21.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of CENPE. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGTATGGCAGAATCGATGAT |
| PCR Primer |
Forward: AACAAAACACACATACGCAAAGATT Reverse: ACCTTAGGGAAGGGTATTTTCAGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.