CECR2 Knockout Cell Line - CD BioSciences

service-banner

CECR2 Knockout Cell Line

CECR2 Knockout Cell Line

SPL-00928

Size Price
1 Unit Online Inquiry
Description
191bp insertion
Target Information
Target Name CECR2
Gene Abbr. CECR2
Gene ID 27443
Full Name CECR2 histone acetyl-lysine reader
Species Human
Genomic Locus chr22:17497509
Transcript NM_031413
WT Expression Level 6.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 191bp insertion in a coding exon of CECR2.
Description 191bp insertion
Parental Cell Line C631
Guide RNA Sequence ATCTCCACCCGTGTGCGAAG
PCR Primer Forward: CTCCTTCTCCCAACCAACCTATATT
Reverse: AAACTCTGGCTTAGTATCTTTGGGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.