Online Inquiry
CECR2 Knockout Cell Line
SPL-00928
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 191bp insertion |
| Target Information | |
|---|---|
| Target Name | CECR2 |
| Gene Abbr. | CECR2 |
| Gene ID | 27443 |
| Full Name | CECR2 histone acetyl-lysine reader |
| Species | Human |
| Genomic Locus | chr22:17497509 |
| Transcript | NM_031413 |
| WT Expression Level | 6.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 191bp insertion in a coding exon of CECR2. |
| Description | 191bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCTCCACCCGTGTGCGAAG |
| PCR Primer |
Forward: CTCCTTCTCCCAACCAACCTATATT Reverse: AAACTCTGGCTTAGTATCTTTGGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.