Cebpe cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cebpe cDNA ORF Clone, Mouse, untagged

Cebpe cDNA ORF Clone, Mouse, untagged

SPD-01763

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse CCAAT/enhancer binding protein (C/EBP), epsilon.
Target Information
Species Mouse
Target Name C/EBPε
Gene Abbr. Cebpe
Gene ID 110794
Full Name CCAAT/enhancer binding protein (C/EBP), epsilon
Alias C/EBP, C/EBPe, C/EBPepsilon, CR, CRP1
Product Details
Description Full length Clone DNA of Mouse CCAAT/enhancer binding protein (C/EBP), epsilon.
NCBI Ref Seq BC108954.1
RefSeq ORF Size 846 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.