CDKN2A Knockout Cell Line - CD BioSciences

service-banner

CDKN2A Knockout Cell Line

CDKN2A Knockout Cell Line

SPL-00918

Size Price
1 Unit Online Inquiry
Description
121bp insertion
Target Information
Target Name p16 INK4A
Gene Abbr. CDKN2A
Gene ID 1029
Full Name cyclin dependent kinase inhibitor 2A
Alias ARF, CDK4I, CDKN2, CMM2, INK4
Species Human
Genomic Locus chr9:21971096
Transcript NM_058195
WT Expression Level 47.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 121bp insertion in a coding exon of CDKN2A.
Description 121bp insertion
Parental Cell Line C631
Guide RNA Sequence TCCCGGGCAGCGTCGTGCAC
PCR Primer Forward: AATTCTCAGATCATCAGTCCTCACC
Reverse: CTCTGACCATTCTGTTCTCTCTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.