Online Inquiry
CDKN1B Knockout Cell Line
SPL-00917
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | p27 Kip1 |
| Gene Abbr. | CDKN1B |
| Gene ID | 1027 |
| Full Name | cyclin dependent kinase inhibitor 1B |
| Alias | CDKN4, KIP1, MEN1B, MEN4, P27KIP1 |
| Species | Human |
| Genomic Locus | chr12:12718115 |
| Transcript | NM_004064 |
| WT Expression Level | 50.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CDKN1B. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGCACCTTTGGGGGGCCGC |
| PCR Primer |
Forward: GTTAACCCGGGACTTGGAGAAG Reverse: CCAAACACATTCTATGGTTGGGAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.