Online Inquiry
CDKN1B cDNA ORF Clone, Human, N-FLAG tag
SPD-10924
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1B (p27, Kip1) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | p27 Kip1 |
Gene Abbr. | CDKN1B |
Gene ID | 1027 |
Full Name | cyclin dependent kinase inhibitor 1B |
Alias | CDKN4, KIP1, MEN1B, MEN4, P27KIP1 |
Introduction | p27 Kip1 is a member of the Cip/Kip family of cyclin-dependent kinase inhibitors. Like its relatives, p57 Kip2 and p21 Waf1/Cip1, the ability to enforce the G1 restriction point is derived from its inhibitory binding to CDK2/cyclin E and other CDK/cyclin complexes. Expression levels of p27 are upregulated in quiescent cells and in cells treated with cAMP or other negative cell cycle regulators. Downregulation of p27 can be induced by treatment with interleukin-2 or other mitogens; this involves phosphorylation of p27 and its degradation by the ubiquitin-proteasome pathway. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1B (p27, Kip1) with N terminal Flag tag. |
NCBI Ref Seq | NM_004064.3 |
RefSeq ORF Size | 636 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.64kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.