CDKN1B cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

CDKN1B cDNA ORF Clone, Human, N-FLAG tag

CDKN1B cDNA ORF Clone, Human, N-FLAG tag

SPD-10924

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1B (p27, Kip1) with N terminal Flag tag.
Target Information
Species Human
Target Name p27 Kip1
Gene Abbr. CDKN1B
Gene ID 1027
Full Name cyclin dependent kinase inhibitor 1B
Alias CDKN4, KIP1, MEN1B, MEN4, P27KIP1
Introduction p27 Kip1 is a member of the Cip/Kip family of cyclin-dependent kinase inhibitors. Like its relatives, p57 Kip2 and p21 Waf1/Cip1, the ability to enforce the G1 restriction point is derived from its inhibitory binding to CDK2/cyclin E and other CDK/cyclin complexes. Expression levels of p27 are upregulated in quiescent cells and in cells treated with cAMP or other negative cell cycle regulators. Downregulation of p27 can be induced by treatment with interleukin-2 or other mitogens; this involves phosphorylation of p27 and its degradation by the ubiquitin-proteasome pathway.
Product Details
Description Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1B (p27, Kip1) with N terminal Flag tag.
NCBI Ref Seq NM_004064.3
RefSeq ORF Size 636 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.64kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.