CDKN1A cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CDKN1A cDNA ORF Clone, Human, untagged

CDKN1A cDNA ORF Clone, Human, untagged

SPD-10907

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1A (p21, Cip1).
Target Information
Species Human
Target Name p21 Waf1/Cip1
Gene Abbr. CDKN1A
Gene ID 1026
Full Name cyclin dependent kinase inhibitor 1A
Alias CAP20, CDKN1, CIP1, MDA-6, P21
Introduction The tumor suppressor protein p21 Waf1/Cip1 acts as an inhibitor of cell cycle progression. It functions in stoichiometric relationships forming heterotrimeric complexes with cyclins and cyclin-dependent kinases. In association with CDK2 complexes, it serves to inhibit kinase activity and block progression through G1/S. However, p21 may also enhance assembly and activity in complexes of CDK4 or CDK6 and cyclin D. The carboxy-terminal region of p21 is sufficient to bind and inhibit PCNA, a subunit of DNA polymerase, and may coordinate DNA replication with cell cycle progression. Upon UV damage or during cell cycle stages when cdc2/cyclin B or CDK2/cyclin A are active, p53 is phosphorylated and upregulates p21 transcription via a p53-responsive element. Protein levels of p21 are downregulated through ubiquitination and proteasomal degradation.
Product Details
Description Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1A (p21, Cip1).
NCBI Ref Seq NM_000389.3
RefSeq ORF Size 495 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.