Online Inquiry
CDK8 cDNA ORF Clone, Human, C-FLAG tag
SPD-03274
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cyclin-dependent kinase 8 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CDK8 |
Gene Abbr. | CDK8 |
Gene ID | 1024 |
Full Name | cyclin dependent kinase 8 |
Alias | IDDHBA, K35 |
Introduction | The mammalian Mediator Complex is a multi-subunit protein complex that couples specific transcriptional regulators to RNA polymerase II (Pol II) and the basal transcription machinery. Interactions between distinct Mediator subunits and transcription factors allow for specific gene regulation.Mediator complex interactions control various biological processes, including insulin signaling NF-κB-dependent signaling stem cell pluripotency and self renewal, and proliferation of colon cancer cells.CDK8/Cyclin C, along with Med12 and Med13, constitute a subcomplex within the Mediator Complex thought to act as a molecular switch, inhibiting Pol II recruitment and transcription initiation. Expression of CDK8 abrogates E2F-1-dependent inhibition of β-catenin activity in colon cancer cells. High levels of CDK8 coincide with high β-catenin-dependent transcription in colon cancer cells, and their proliferation can be inhibited by suppressing CDK8 expression.CDK8 can phosphorylate Ser727 on STAT1, which reduces natural killer (NK) cell toxicity. As such, inhibitors are being pursued as potential therapeutics to enhance NK cell activity and combat a variety of cancer types. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cyclin-dependent kinase 8 with C terminal Flag tag. |
NCBI Ref Seq | NM_001260.1 |
RefSeq ORF Size | 1434 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + NotI (6kb + 1.43kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.