CDK5RAP1 Knockout Cell Line - CD BioSciences

service-banner

CDK5RAP1 Knockout Cell Line

CDK5RAP1 Knockout Cell Line

SPL-00901

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name CDK5RAP1
Gene Abbr. CDK5RAP1
Gene ID 51654
Full Name CDK5 regulatory subunit associated protein 1
Alias C20orf34, C42, CGI-05, HSPC167
Species Human
Genomic Locus chr20:33395015
Transcript NM_016408
WT Expression Level 53.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of CDK5RAP1.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence CTTGGAGGTTACTGGTCCGC
PCR Primer Forward: CTGGAACAAAAGTACAACTCAGTCC
Reverse: TAGGGGACTTAGTGGATAACCAGAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.