Online Inquiry
CDK5RAP1 Knockout Cell Line
SPL-00900
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | CDK5RAP1 |
| Gene Abbr. | CDK5RAP1 |
| Gene ID | 51654 |
| Full Name | CDK5 regulatory subunit associated protein 1 |
| Alias | C20orf34, C42, CGI-05, HSPC167 |
| Species | Human |
| Genomic Locus | chr20:33395015 |
| Transcript | NM_016408 |
| WT Expression Level | 53.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of CDK5RAP1. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTGGAGGTTACTGGTCCGC |
| PCR Primer |
Forward: CTGGAACAAAAGTACAACTCAGTCC Reverse: TAGGGGACTTAGTGGATAACCAGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.