Online Inquiry
CDK5R1 cDNA ORF Clone, Human, N-His tag
SPD-03270
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CDK5R1 |
Gene Abbr. | CDK5R1 |
Gene ID | 8851 |
Full Name | cyclin dependent kinase 5 regulatory subunit 1 |
Alias | CDK5P35, CDK5R, NCK5A, p23, p25 |
Introduction | Cyclin-dependent kinases (CDKs) are serine/threonine kinases that are activated by cyclins and govern eukaryotic cell cycle progression. While CDK5 shares high sequence homology with its family members, it is thought mainly to function in postmitotic neurons, regulating the cytoarchitecture of these cells. Analogous to cyclins, p35 and p39 associate with and activate CDK5 despite the lack of sequence homology. CDK5 is ubiquitously expressed, but high levels of kinase activity are detected primarily in the nervous system due to the narrow expression pattern of p35 and p39 in post-mitotic neurons. A large number of CDK5 substrates have been identified although no discrete substrates have been attributed as a function of p35 vs. p39. Amongst many, substrates of CDK5 include p35 and p39. p35 is rapidly degraded (T1/2 <20 min) by the ubiquitin-proteasome pathway. However, p35 stability increases as CDK5 kinase activity decreases, and this is likely a result of decreased phosphorylation of p35 at Thr138 by CDK5. NGF activates Erk and EGR1, and induces p35 expression in PC12 cells. Proteolytic cleavage of p35 by calpain produces p25 upon neurotoxic insult, resulting in prolonged activation of CDK5 by p25. Accumulation of p25 is found in neurodegenerative diseases such as Alzheimer's disease and Amyotrophic Lateral Sclerosis (ALS). |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) with N terminal His tag. |
NCBI Ref Seq | NM_003885.2 |
RefSeq ORF Size | 924 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.