CDK5R1 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

CDK5R1 cDNA ORF Clone, Human, C-Myc tag

CDK5R1 cDNA ORF Clone, Human, C-Myc tag

SPD-03266

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) with C terminal Myc tag.
Target Information
Species Human
Target Name CDK5R1
Gene Abbr. CDK5R1
Gene ID 8851
Full Name cyclin dependent kinase 5 regulatory subunit 1
Alias CDK5P35, CDK5R, NCK5A, p23, p25
Introduction Cyclin-dependent kinases (CDKs) are serine/threonine kinases that are activated by cyclins and govern eukaryotic cell cycle progression. While CDK5 shares high sequence homology with its family members, it is thought mainly to function in postmitotic neurons, regulating the cytoarchitecture of these cells. Analogous to cyclins, p35 and p39 associate with and activate CDK5 despite the lack of sequence homology. CDK5 is ubiquitously expressed, but high levels of kinase activity are detected primarily in the nervous system due to the narrow expression pattern of p35 and p39 in post-mitotic neurons. A large number of CDK5 substrates have been identified although no discrete substrates have been attributed as a function of p35 vs. p39. Amongst many, substrates of CDK5 include p35 and p39. p35 is rapidly degraded (T1/2 <20 min) by the ubiquitin-proteasome pathway. However, p35 stability increases as CDK5 kinase activity decreases, and this is likely a result of decreased phosphorylation of p35 at Thr138 by CDK5. NGF activates Erk and EGR1, and induces p35 expression in PC12 cells. Proteolytic cleavage of p35 by calpain produces p25 upon neurotoxic insult, resulting in prolonged activation of CDK5 by p25. Accumulation of p25 is found in neurodegenerative diseases such as Alzheimer's disease and Amyotrophic Lateral Sclerosis (ALS).
Product Details
Description Full length Clone DNA of Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) with C terminal Myc tag.
NCBI Ref Seq NM_003885.2
RefSeq ORF Size 924 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.97kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.