CDK5 Knockout Cell Line - CD BioSciences

service-banner

CDK5 Knockout Cell Line

CDK5 Knockout Cell Line

SPL-00897

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name CDK5
Gene Abbr. CDK5
Gene ID 1020
Full Name cyclin dependent kinase 5
Alias LIS7, PSSALRE
Species Human
Genomic Locus chr7:151056955
Transcript NM_004935
WT Expression Level 42.38 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of CDK5.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GTGTGCCGAGTTCCGCCCTC
PCR Primer Forward: CTATACCTTCCCAAGGCTACTGTC
Reverse: CCTTCATTTTAGACATCCTTGCCCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.