Online Inquiry
CDK5 Knockout Cell Line
SPL-00896
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 49bp deletion |
| Target Information | |
|---|---|
| Target Name | CDK5 |
| Gene Abbr. | CDK5 |
| Gene ID | 1020 |
| Full Name | cyclin dependent kinase 5 |
| Alias | LIS7, PSSALRE |
| Species | Human |
| Genomic Locus | chr7:151056955 |
| Transcript | NM_004935 |
| WT Expression Level | 42.38 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 49bp deletion in a coding exon of CDK5. |
| Description | 49bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTGTGCCGAGTTCCGCCCTC |
| PCR Primer |
Forward: CTATACCTTCCCAAGGCTACTGTC Reverse: CCTTCATTTTAGACATCCTTGCCCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.