Online Inquiry
Cdk4 cDNA ORF Clone, Rat, N-HA tag
SPD-03232
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat cyclin-dependent kinase 4 with N terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | CDK4 |
Gene Abbr. | Cdk4 |
Gene ID | 94201 |
Full Name | cyclin-dependent kinase 4 |
Introduction | Cyclin-dependent kinase activity is regulated by T-loop phosphorylation (Thr172 in the case of CDK4), by the abundance of their cyclin partners, and by association with CDK inhibitors of the Cip/Kip or INK family of proteins. The inactive ternary complex of CDK4/cyclin D and p27 Kip1/Cip1 requires extracellular mitogenic stimuli for the release and degradation of p27, which affects progression through the restriction point and pRb-dependent entry into S-phase. The active complex of CDK4/cyclin D targets the retinoblastoma protein for phosphorylation, allowing the release of E2F transcription factors that activate G1/S-phase gene expression. In HeLa cells, upon UV irradiation, upregulation of p16 INK4A association with CDK4/cyclin D3 leads to a G2 delay, implicating CDK4/cyclin D3 activity in progression through the G2-phase of the cell cycle. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat cyclin-dependent kinase 4 with N terminal HA tag. |
NCBI Ref Seq | NM_053593.2 |
RefSeq ORF Size | 912 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.