Cdk4 cDNA ORF Clone, Rat, C-His tag - CD BioSciences

service-banner

Cdk4 cDNA ORF Clone, Rat, C-His tag

Cdk4 cDNA ORF Clone, Rat, C-His tag

SPD-03225

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat cyclin-dependent kinase 4 with C terminal His tag.
Target Information
Species Rat
Target Name CDK4
Gene Abbr. Cdk4
Gene ID 94201
Full Name cyclin-dependent kinase 4
Introduction Cyclin-dependent kinase activity is regulated by T-loop phosphorylation (Thr172 in the case of CDK4), by the abundance of their cyclin partners, and by association with CDK inhibitors of the Cip/Kip or INK family of proteins. The inactive ternary complex of CDK4/cyclin D and p27 Kip1/Cip1 requires extracellular mitogenic stimuli for the release and degradation of p27, which affects progression through the restriction point and pRb-dependent entry into S-phase. The active complex of CDK4/cyclin D targets the retinoblastoma protein for phosphorylation, allowing the release of E2F transcription factors that activate G1/S-phase gene expression. In HeLa cells, upon UV irradiation, upregulation of p16 INK4A association with CDK4/cyclin D3 leads to a G2 delay, implicating CDK4/cyclin D3 activity in progression through the G2-phase of the cell cycle.
Product Details
Description Full length Clone DNA of Rat cyclin-dependent kinase 4 with C terminal His tag.
NCBI Ref Seq NM_053593.2
RefSeq ORF Size 912 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.