Cdk2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cdk2 cDNA ORF Clone, Mouse, untagged

Cdk2 cDNA ORF Clone, Mouse, untagged

SPD-03213

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 2, transcript variant 2.
Target Information
Species Mouse
Target Name CDK2
Gene Abbr. Cdk2
Gene ID 12566
Full Name cyclin-dependent kinase 2
Alias A630093N05Rik
Introduction Cyclin-dependent kinase 2 (p33CDK2) is an important component of the cell cycle machinery. Like p34cdc2, kinase activity is regulated by phosphorylation state as well as association with a cyclin subunit and a CDK inhibitor. Inhibitory phosphorylation occurs on Thr14 and Tyr15. Inhibition of CDK2-cyclin complexes can also be attributed to association with p27 Kip1 and p21 Waf1/Cip1. Activation of CDK2 complexes requires dephosphorylation of Thr14 and Tyr15 by cdc25 phosphatase and phosphorylation of Thr160 which is mediated by CAK, a complex of CDK7 and cyclin H. CDK2/cyclin E kinase activity is important for the G1 to S transition and phosphorylation of the Rb protein. During S-phase, active CDK2/cyclin A complexes predominate and phosphorylate E2F and the active CDK2 complex persists in the nucleus throughout G2.
Product Details
Description Full length Clone DNA of Mouse cyclin-dependent kinase 2, transcript variant 2.
NCBI Ref Seq NM_016756.4
RefSeq ORF Size 897 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.