Online Inquiry
CDK2 cDNA ORF Clone, Human, N-FLAG tag
SPD-03219
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cyclin-dependent kinase 2 ,transcript variant 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CDK2 |
Gene Abbr. | CDK2 |
Gene ID | 1017 |
Full Name | cyclin dependent kinase 2 |
Alias | CDKN2, p33(CDK2) |
Introduction | Cyclin-dependent kinase 2 (p33CDK2) is an important component of the cell cycle machinery. Like p34cdc2, kinase activity is regulated by phosphorylation state as well as association with a cyclin subunit and a CDK inhibitor. Inhibitory phosphorylation occurs on Thr14 and Tyr15. Inhibition of CDK2-cyclin complexes can also be attributed to association with p27 Kip1 and p21 Waf1/Cip1. Activation of CDK2 complexes requires dephosphorylation of Thr14 and Tyr15 by cdc25 phosphatase and phosphorylation of Thr160 which is mediated by CAK, a complex of CDK7 and cyclin H. CDK2/cyclin E kinase activity is important for the G1 to S transition and phosphorylation of the Rb protein. During S-phase, active CDK2/cyclin A complexes predominate and phosphorylate E2F and the active CDK2 complex persists in the nucleus throughout G2. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cyclin-dependent kinase 2 ,transcript variant 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_001798.3 |
RefSeq ORF Size | 897 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 0.94kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.