Online Inquiry
CDK19 Knockout Cell Line
SPL-00893
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | CDK19 |
| Gene Abbr. | CDK19 |
| Gene ID | 23097 |
| Full Name | cyclin dependent kinase 19 |
| Alias | CDC2L6, CDK11, DEE87, EIEE87, bA346C16.3 |
| Species | Human |
| Genomic Locus | chr6:110815068 |
| Transcript | NM_015076 |
| WT Expression Level | 11.52 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein that is one of the components of the Mediator co-activator complex. The Mediator complex is a multi-protein complex required for transcriptional activation by DNA binding transcription factors of genes transcribed by RNA polymerase II. The protein encoded by this gene is similar to cyclin-dependent kinase 8 which can also be a component of the Mediator complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CDK19. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGATTTGTTTGAGTACGAA |
| PCR Primer |
Forward: GCCCCTGCTCTTACCCATCTT Reverse: CGGCTGTTGGAGAAGTGGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.