Online Inquiry
CDK16 Knockout Cell Line
SPL-00887
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | CDK16 |
| Gene Abbr. | CDK16 |
| Gene ID | 5127 |
| Full Name | cyclin dependent kinase 16 |
| Alias | PCTAIRE, PCTAIRE1, PCTGAIRE, PCTK1 |
| Species | Human |
| Genomic Locus | chrX:47223614 |
| Transcript | NM_006201 |
| WT Expression Level | 214.47 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It may play a role in signal transduction cascades in terminally differentiated cells; in exocytosis; and in transport of secretory cargo from the endoplasmic reticulum. This gene is thought to escape X inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of CDK16. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CATTGGTCTTGTCTATGCCT |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTGGACTGAGGAGGCCATCATA Reverse: CATGCTGGGTTTCCAGAACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.