Online Inquiry
CDK11A Knockout Cell Line
SPL-00884
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | CDK11A |
| Gene Abbr. | CDK11A |
| Gene ID | 728642 |
| Full Name | cyclin dependent kinase 11A |
| Alias | CDC2L2, CDC2L3, CDK11-p110, CDK11-p46, CDK11-p58 |
| Species | Human |
| Genomic Locus | chr1:1704939 |
| Transcript | NM_024011 |
| WT Expression Level | 20.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of CDK11A. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGATGGTGTTGATCTCCCTC |
| PCR Primer |
Forward: CCACTTGTACGCAGACAGGA Reverse: TGTTGGTACCGTGACTTTGAGAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.