Online Inquiry
Cdh1 cDNA ORF Clone, Rat, N-His tag
SPD-04723
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat cadherin 1 with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | E-Cadherin |
Gene Abbr. | Cdh1 |
Gene ID | 83502 |
Full Name | cadherin 1 |
Introduction | Cadherins are a superfamily of transmembrane glycoproteins that contain cadherin repeats of approximately 100 residues in their extracellular domain. Cadherins mediate calcium-dependent cell-cell adhesion and play critical roles in normal tissue development. The classic cadherin subfamily includes N-, P-, R-, B-, and E-cadherins, as well as about ten other members that are found in adherens junctions, a cellular structure near the apical surface of polarized epithelial cells. The cytoplasmic domain of classical cadherins interacts with β-catenin, γ-catenin (also called plakoglobin), and p120 catenin. β-catenin and γ-catenin associate with α-catenin, which links the cadherin-catenin complex to the actin cytoskeleton. While β- and γ-catenin play structural roles in the junctional complex, p120 regulates cadherin adhesive activity and trafficking. Investigators consider E-cadherin an active suppressor of invasion and growth of many epithelial cancers. Research studies indicate that cancer cells have upregulated N-cadherin in addition to loss of E-cadherin. This change in cadherin expression is called the "cadherin switch." N-cadherin cooperates with the FGF receptor, leading to overexpression of MMP-9 and cellular invasion. Research studies have shown that in endothelial cells, VE-cadherin signaling, expression, and localization correlate with vascular permeability and tumor angiogenesis. Investigators have also demonstrated that expression of P-cadherin, which is normally present in epithelial cells, is also altered in ovarian and other human cancers. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat cadherin 1 with N terminal His tag. |
NCBI Ref Seq | NM_031334.1 |
RefSeq ORF Size | 2661 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.