Cdh1 cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Cdh1 cDNA ORF Clone, Rat, N-HA tag

Cdh1 cDNA ORF Clone, Rat, N-HA tag

SPD-04725

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat cadherin 1 with N terminal HA tag.
Target Information
Species Rat
Target Name E-Cadherin
Gene Abbr. Cdh1
Gene ID 83502
Full Name cadherin 1
Introduction Cadherins are a superfamily of transmembrane glycoproteins that contain cadherin repeats of approximately 100 residues in their extracellular domain. Cadherins mediate calcium-dependent cell-cell adhesion and play critical roles in normal tissue development. The classic cadherin subfamily includes N-, P-, R-, B-, and E-cadherins, as well as about ten other members that are found in adherens junctions, a cellular structure near the apical surface of polarized epithelial cells. The cytoplasmic domain of classical cadherins interacts with β-catenin, γ-catenin (also called plakoglobin), and p120 catenin. β-catenin and γ-catenin associate with α-catenin, which links the cadherin-catenin complex to the actin cytoskeleton. While β- and γ-catenin play structural roles in the junctional complex, p120 regulates cadherin adhesive activity and trafficking. Investigators consider E-cadherin an active suppressor of invasion and growth of many epithelial cancers. Research studies indicate that cancer cells have upregulated N-cadherin in addition to loss of E-cadherin. This change in cadherin expression is called the "cadherin switch." N-cadherin cooperates with the FGF receptor, leading to overexpression of MMP-9 and cellular invasion. Research studies have shown that in endothelial cells, VE-cadherin signaling, expression, and localization correlate with vascular permeability and tumor angiogenesis. Investigators have also demonstrated that expression of P-cadherin, which is normally present in epithelial cells, is also altered in ovarian and other human cancers.
Product Details
Description Full length Clone DNA of Rat cadherin 1 with N terminal HA tag.
NCBI Ref Seq NM_031334.1
RefSeq ORF Size 2661 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.