CDC42BPB Knockout Cell Line - CD BioSciences

service-banner

CDC42BPB Knockout Cell Line

CDC42BPB Knockout Cell Line

SPL-00878

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name CDC42BPB
Gene Abbr. CDC42BPB
Gene ID 9578
Full Name CDC42 binding protein kinase beta
Alias MRCKB
Species Human
Genomic Locus chr14:102986531
Transcript NM_006035
WT Expression Level 29.73 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of CDC42BPB.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence CGTGAATGGTCATATCCGCC
PCR Primer Forward: ACTCCCCAAACAGAAAATTTCAACT
Reverse: ATCACCACTAGTTAAGGGCTTTGAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.